Mi lista de blogs

martes, 29 de noviembre de 2011

Navidades sin pascuero


Estoy tan pesimamente mal de dinero
que esta navidad no sé porque me da
le van a dar por culo al pascuero.
Y para comer, dudo que haya para cordero.

Caldo de gallina vieja si acaso y vamos a ver
si alcanza para no tener que tirar
de las tajadas de la matanza
de hace una temporada o dos.

Huelo el lomo en manteca
y ya siento el ardor

¿Puede ser una navidad como dios manda
sin pascuero ni cordero?
Para mí NO.

Esa planta que dura como máximo
hasta mediados de Enero
no ha de faltar en una casa
que tenga la dignidad
de celebrar la Navidad
como dios manda, desde hace ya!

¡Sin  pascuero, ni cordero!!

Ya nada me espanta
ni la maldita prima de riesgo
que tanto aprieta a italianos
españoles y griegos.

A lo que me pienso negar
desde luego!!
es a tener que comerme el puchero
de días atrás

En día tan apreciado
¡¡Y además sin pascuero!!
esperemos que no manden las hambres
y  no nos lo hagan TRAGAR

¡¡Feliz Navidad!!
Tu, si tienes pascuero
¿verdad?
..Así lo espero
por el bien, sobre todo,
del bienestar de tu agujero
anal
y de tu salud mental

Una navidad sin pascuero
no es navidad ni ná

jueves, 17 de noviembre de 2011

Me mata la crisis


Señores!! Está la cosa que trina
Hoy he visto una banda
de ejecutivos desocupados
echarle  un mus a unos albañiles parados

Se jugaban a parte del honor,
y una lata de sardinas.
¡que empeño ponían los dos!

Por dios,
y que ardor!!
Un corro de funcionarias,
sin gran cosa que hacer
jaleaban las jugadas.
¡¡Envida y termina!!

Terminada la jugada
una funcionaria entrada en kilos y canas
se hace la despistada.

Cuando se levanta la timba
anda con mano diestra
para recoger el tanteo
¡¡un puñado de garbanzos
bien manoseados por cierto
con los que poder hacer un puchero
y dar de comer a su manada.

A eso vamos apuntando
después de pasar del  cuatrocientos
y pico al quinientos
esta misma semana.

Cago en las ondas herzias
que todo lo aclaman.

..Cago en las amenazas!!

Esta semana aún “semos” ricos
Aprovecha y cómete a Crédito
una buena mariscada..
antes de ir a jugar
..al lugar

miércoles, 26 de octubre de 2011

Otoño sin sementera


Si alguien me preguntara alguna vez
que es lo que más me gusta del otoño,
me sería muy difícil de responder.

Me gustan las granadas y sus manchas,
Las castañas de las dos clases.
El bigotillo blanco de la montaña
El olor y sabor de matanza.

El humo de la lumbre
que casi todo lo apaña,
El sabor a calostros,
la leche de cabra.

Cuando tenía menos edad ,
y no vivía en la ciudad
perdía la misma vida
por las majoletas ,un canutero de caña
y la niña de mis ojos,  para disparar

También pierdo el sentido por
una miaja de frío.
Si es acompañado de viento
y gotas que se estampan contra el cristal
para que pedir más

Son esos momentos los que me llenan
de emoción a rebozar.

Siempre me imagino en la cama.
Acurrucado y calentito
escuchando el repicar sobre le cristal.
A eso de las seis de la mañana, me levanto
con la intención de correr.
Es duro lo sé. Pero grande la determinación

Así que me levanto
Corro la cortina,
observo cómo se estrellan las gotas en el cristal
y me digo con algo de frío:
“Este día está  muy mal”
Me doy la vuelta
y  me vuelvo a enroscar

¿Hay felicidad que se le pueda igualar?

Para mí van quedando pocas, la verdad
Por eso y mucho más
te doy la bienvenida, Otoño.
Te voy a disfrutar a tope
¡que lo sepas gañan!
cuando menos acordemos
tenemos la Navidad
Que es la culpable de que
el rollo ya no sea igual
¿verdad?



viernes, 30 de septiembre de 2011

¿ Zorollos?

Al término zorollo le damos en Granada varias acepciones, que si te pones a pensar es la misma, la verdad.
Si se trata de comida, está cuando le falta un hervor, si es en relación a las personas más o menos igual.

En la comida es muy fácil de distinguir, pero ¿Cómo se distingue un zorollo en la vida civil?

No es el tema hacer una clasificación de zorollos, siendo como soy, un lego en la materia  total .

La cuestión responde a una observación.
Resulta que hoy estaba apuntado a un evento tecnológico que, según la agenda, debía de empezar a las diez. No diré el patrocinador. Ni hablaré de su poco poder de convocatoria.

¡¡Cuatro gatos mal contados!! De los setenta esperados, se lee previstos, apenas llegábamos a ocho .¡ Y aquello que no empezaba ni “pa dios”!

Entiendo que esperando el maná de la “maná” para poder justificar el gasto de manera oficial.

En los tres cuartos de hora que van desde las diez a las once menos cuarto, que decidí abandonar el evento,( por no acabar de arrancar) me dio por observar a las dos clases de elementos que pululaban por el lugar:

Los ponentes y los zorollos

Los ponentes vienen a gastos pagados. A carrillo batido van dando cuenta de zumos, tostadas y café, mirando con disimulo quien entra por la puerta para sumar audiencia .

Los zorollos andan con su IPAD o su IPOD conectados a Internet sin ningún estrés.
¡!Les da igual que aquello comience a las diez o a las tres ¡¡ Estando conectados a las redes sociales y/o Internet se les acaban las prisas.

Cara de borregos degollados. Puro placer. Mansos.

La pregunta no está de más:

¿Nos vuelve Internet zorollos?
¿Nos calman los demonios el mundo virtual?
O es que nos estamos volviendo zorollos de verdad y no nos damos cuenta.

Mejor no hecho cuentas, “cachis” en la mar

lunes, 22 de agosto de 2011

Vacaciones en el mal

Sin querer, a volapié y en un chimpún se me han ido escapando los días de mis vacaciones como esos pececillos que cuando uno es pequeñito nunca llega atrapar.

Como todo español que se precie, las mías, me refiero a la vacación han sido cerca de la mar. En un cortijo. ¡¡Toma ya!!

Muy parecido a los que los de la capital llaman casa rural. Con su huerta ¡¡ Qué bonita cuándo no se tiene que regar!! Con sus perros que ladran a deshoras y si no…se ponen a maullar. Con el canto del hijo de la grandísima puta del gallo del vecino, que incitaba a los demás. A eso de las cinco y medía empezaba la función

Quiquiriquí por aquí, quiquiriquí por allá. ¡¡Qué precioso amanecer, copón!!

A mi modo de ver un cortijo es lo que es. La casa que se hizo un inadaptado social que no quería saber de los demás ná de ná. Si se unen varias casas entonces se llama “cortijá” Y ya es lo mismo que un pueblo o una ciudad.. en cuanto a la mala leche que se gasta el personal. “Esa linde es mía, que me has movido el mojón”..A la de poco… a escopetazo que te crió, y se acaba la discusión, por la mierda el mojón.

Bonitos son los cortijos cojones. Perdón, quería decir casa rurales

La última semana, no ha hecho ni gota de calor. Nooo. ¡¡Qué fresquito entre las sábanas, inundado de ese sudor frío, que a uno le entra cuando no puede degollar al gallo que lo despierta.

Y ¿de las moscas qué? Bien parece que las muy cabronas me persiguieran. Allá donde vaya hay una buena reata..incluida la playa, planeándome por la calva
Descansan a eso de pasadas las diez. A las moscas me refiero. Se ve que les da la modorra o algo y se van a tomar por culo, no sin antes avisar a los mosquitos para que te taladren hasta el paladar, no sin avisar.
Todavía me silba un oído de las hostias que ha recibido. Pooomm..y ná, el mosquito a volar y a seguir con su tonillo celestial.

De mi suegra hoy no voy hablar. No.
Perdonad

Bonitas han sido mis vacaciones en el mar.

Yo quiero máaaas, yo quiero másssss

Me faltan mis cuñados!! Que apañados y que participativos . " El arrohh ta zozo y le zobra una arroba ajeite” "La jerveja ta mah caliente que el culo la burra” y delicatesen por el estilo

Contando estoy los días que faltan para Navidad, pa irme otra vez al cortijo o casa rural

sábado, 30 de julio de 2011

Receta: Boquerones en su ser

Pocos manjares hay comparables a los boquerones en su ser. Cierto es.

Lo mismo que también, hay que esirlo no todo el mundo se atreve con la intrepidez. Peor para ellos .¿Qué le vamos hacer?

Para recordar la receta, no es preciso ser un empollón, ni siquiera tener un memorión.
Simple del copón. Apunta, pero no dispares, no vayamos a tener un disparate antes de contarte como se hace.

Debe ser el boquerón más fresco que el copón. Ojos de ver. Tripas sin asomar. Firme de carnes, brillante, con todas (o la mayor parte) de sus escamas.


Que te hable!!

Llegada la transacción, no te hagas el longui y los llevas con premura al congelador. Hay que matarle el Anasagestesis ese, que según estudios sesudos, parece que el congelata lo atonta. Desde la virtuosa cabellera hasta las nalgas. O sea que el bicho ya no hace nada.

Una vez congelados y tiesos como garrotes los sacas. Los dejas a su ser , hasta verlos como los viste ayer. Los destripas. Le quitas la raspa. Los divides en dos, si te sale de un cojón..o de los dos. Los lavas. Los secas (si te sale) yo no lo hago jamás. Y los vas disponiendo en un plato ¡¡limpio!!.


Poquita de sal. No tiene que ser Maldon, ni nada especial. Aceite. Arbequina es el mejor. Un chorreón pequeñito. No se trata de que vuelva a nadar el boquerón.


El vino que mejor le va es un manzanilla en rama, un amontillado, un jerez seco o un Mencal.

Y ya está.
¿ Difícil verdad?

Disfrute total. Para mí, no sé si para los demás

miércoles, 20 de julio de 2011

Lo que falta es...Mencal

La gente que conozco de mi edad, va perdiendo el desenfreno carnal, (aunque quede muy mal decirlo), y lo va cambiando por otros vicios.

Los míos son largos de contar. Me gusta el flamenco a rabiar, viajar, la mar, pescar, campear y un largo etcétera que no pienso contar. Por no aburrir más que .

En el que casi todos los carrozones, entre los que me encuentro, estamos de acuerdo es en las cosas de la comienda (no confundir con jodienda) y el trasiego. Nos gusta tanto comer y beber mejor, como contarlo.

Si además, eres cocinillas como es mi caso, apagáremos.
Te doy permiso para dejar de leer porque te voy a dar el tostón con el pedazo vino que descubrí ayer.




Yo siempre hago el mismo chiste, ahora que todo el mundo sabe tantísimo de vinos. Cuando me lo dan a catar en el Restaurante, y siempre me toca (debo tener una cara borracho muy grande) le pego movimientos circulares a la copa, lo huelo, pongo cara de idiota después de llevármelo a la boca, para de inmediato decir: "Efectivamente es tinto"

Quiero decir con esto, que no me tengo por experto "Ni falta que me importa" que diría mi amigo Vallecillos, pero la sensación de felicidad fue aumentando según llenaba la copa de Mencal, entré cuchará y cuchará de un marmitako de salmón y setas de pie azul del que puedes leer la receta en Internet. Yo..no la pienso poner.

Una exageración la mezcla. El Mencal fresquito ¡qué bien entra XD!
Rebañado con su pan los restos, termino la botella con un helado de turrón.
Apoteosis.
Ganas de trincar.

Mentira es lo que a esta edad se pasa el desenfreno carnal.
Lo que falta es Mencal.!!

viernes, 24 de junio de 2011

Corpus en Granada

Corpus en Graná.!!
Ahí es ná.

La Gran Vía se llena
de abuelos con nietos,
de parados sin razón,
de mocitas de buen ver,
de niños con ilusión,
de gigantes y cabezudos,
y “guiris” a mogollón
....

Más abajo,
en la Fuente las Batallas
estarán los puestos de cerámica,
el que baila que se las pela,
el trilero con su compañero,
músicos andinos tocando
el cóndor pasa,
un puesto de finas corbatas

Un tío con gorro blanco se afana
y grita “ A la rica garrapiñada”.
Negros a tropel venden magníficos cedés.

Justo al lado,
uno con bigotillo fino y aire desgarbado
infla los globos a destajo
con una botella del copón
…”Papá yo quiero un caballo”

"Estáutas" que saludan por un real
y toda la marabunta que sigue cualquier ferial.

Son días de feria en Graná.

lunes, 20 de junio de 2011

Va de redes

Si le preguntas a un pescador por una red, lo más probable es que te dará pelos y señales de las que tiene para pescar.

Si se lo preguntas a Nadal, te dirá que es la que separa un campo de tenis.

Eduardo Punset, te dirá, que en plural es un programa que dirige él. Concretamente en la dos de televisión.

También es, lo que guarda el cancerbero , lo que utiliza el pajarero, o lo que usan las señoras para el pelo..

Faceboot , twitter, tuenti..Si responde un jovenzuelo.

Según mi opinión, todas las redes son importantes, pero estas últimas son el copón

domingo, 19 de junio de 2011

Granada es de primera

Hoy me siento superior. Si no fuera porque alguien me está tocando el tambor, dentro de la mollera..
La resaca es lo que tiene. Cerveza, vino, jamón y langostinos

...GOOOOOL del negro..

Luego más alcohol..y otro golecillo de los otros..
Miedo. Cagalera.
El minutero que no acelera.
Esto se alarga más que dios.

Por fin

…PITOOOOÓ

Se acabó

..Abrazos y cánticos
Una pea der copón.
Celebración

..Llena otra, pol favol.

De la casa el vecino a mi puerta
hay cincuenta metros..
¡¡que larguísimossss!!!copón

Me meo en la calle
..que cochino, por favor

La cancela no abre..joputa la llave

¡¡Anda..si no es esta!!

Luego me acuesto y sueño con ríos inmensos.
Me levanto con la garganta dañá..y con la cabeza embotá
pero ya está en PRIMERA el Graná

Hombre rural = a hombre tosco

¡¡ Qué precisión en la definición, copón!!
Ahí va lo que dice del hombre rural
la Real, alias RAE ,en una acepción

"Inculto, tosco, apegado a cosas lugareñas"

Que no se entere la peña
¡¡ que puedee haber leña!!
...leñeee (en franchute)

Decía uno de mi pueblo, con razón,
que el animal más parecido al hombre,
era el cortijero, u hombre rural.

El que esto decía, venia de la ciudad
y no doblaba la espina con el legón

Ya no calzan boina ni albarcas.
Saben poco de la vida virtual.
Hasta con el móvil, se atrancan
cuando te quieren retratar.


Aplaudo y felicito,
sin escurrir el bulto,
a los académicos de la real
por tan sabia definición
del cortijero inculto.

Me han trasplantado a la ciudad.
Los fines de semana me escapo
a visitar al hombre rural
y doy fé de que me lo paso fatal
...entre tanto animal...

viernes, 17 de junio de 2011

El silencio

Cuando una empresa que comienza
y solicita una oferta de servicio,
poniendo las cartas sobre la mesa
¿Hay algo peor que decir sí o no?

¡¡Sorpresaaaaaaaaaaa!!

La hay, sí señor.
Y según mi opinión es esta:
La NO respuesta del vendedor.

Aunque me pase con frecuencia,
no me llegaré acostumbrar
por nunca jamás…
y no diré de la praxis
..empresarial

sábado, 11 de junio de 2011

Por mi pepino

Gracias a la impaciencia
de una señora germana,
que no se anduvo por las rama
a la hora de mentir,
se le han quitado a mí pepino
las ganas de comprar en LIDL.

De Mercedes, salchichas
y otras porquerías más
...
también me da,
que de las germanas,
me voy a quitar

La rubia y la culona
no dan marcha atrás
….
Yo tampoco la voy a dar

domingo, 5 de junio de 2011

¿Seré gallina?

Según me van pesando los días, me observo y veo con desconcierto mi figura en el espejo. Se me está poniendo cara de huevo cocido,colega.

Si bajo la mirada y observo todo el panorama, le doy un cierto parecido a las gallinas golletas.

A decir verdad, soy calcado a la golleta, ¡¡qué puñeta!!

Ambos tenemos andares desgarbados, mirada ausente. Ganas de cacarear. Tic repentinos. A ambos nos encanta el pepino y tumbarnos a la sombra de un olivo.

Tenemos, según mis cuentas, algunas pequeñas diferencias. Ella ponía todos los días un huevo de dos yemas. Yo por más que lo intento, a lo que se ve nunca me llega a cuajar y no voy a decir lo que llego a echar.

¿Me estaré volviendo gallina? ¿Lo mismo lo he sido siempre y me doy cuenta ahora de repente?

Me encanta picotear por aquí y por allá. Me encanta el olor a cuadra. Los perfumes del muladar.

Por las ortigas pierdo el sentido. Las mejores que comí jamás las preparan en un sitio dedicado a preparar productos selectos de la mar. Se llama el campero. Gran contradicción compadre.

El cereal lo he incorporado a mi dieta. Como maíz y trigo integral.
¿Pero quién me iba a decir a mí, siendo más del campo que un chaparro, y teniendo ya esta edad que el salvado me iba a pirrar?

¿Haré buen caldo?

No sé, no sé. La mezcla perfecta en mi caso sería, mitad gallina, mitad guarro

miércoles, 1 de junio de 2011

Marujo

Dentro de poco hará dos meses
que ejerzo de marujo.
No. No te equivoques.
He dicho marujo, no cartujo.

Marujo a secas, sus labores.

Si no fuera por lo difícil que es
complacer los gustos de la mujer
hasta diría, que me va superior

Puedo decir, sin ánimo de ofender,
que este nuevo rol
a mi persona pelona
le produce poco estrés.

Me encanta cocinar.
Ir al mercado a comprar.
¡¡hasta le he cogido el puntillo
a limpiar y a fregar!!

Me falta a mi modo de ver
para ser un marujo total
disponer de una lengua bífida
dispuesta a rajar de los demás

Engancharme a un culebrón
o al posgrama del maricón
..pero todo se andará

lunes, 30 de mayo de 2011

A Paco le Lucia

Hay días que al llegar a casa me aguarda Paco.
¿Qué que Paco?
El del retaco.
El que con sus dedos mágicos
tiene cojones de liarte el taco.



Y ahí me ves palmeando con los pies
y andando con garbo flamenco a más no poder.

La pluma no se me ha llegado a secar del tó
pero es imposible describir esta emoción
tttttttacacacacacaca
tacccacacacccaccaca
tocoocococcocotonton..

domingo, 22 de mayo de 2011

RefleSIoNO

Deshojo la margarita
Si, no, si, no
...
RefleSIoNO
y…
me acojono.
….
Si, no, si, no.

Valiente embrollo!!

Ganas me dan
de tirarme un follo
y mandar mi derecho
al puto deshecho

sábado, 21 de mayo de 2011

Erección edílica

Volutas de habano recién robado
se atropellan en filigrana
sobre la calva de un militar en paro

Señoras de quintal
rezan con devoción celestial
con un nabo asado
en el bolsillo del delantal.

Regüeldos de aleluyas.

Palomas de la paz
picotean sin cesar
el cadáver de un
aprendiz de albañil
de muy corta edad.

Malvas y rojos en el muladar.

Erección general

Ea..todo el mundo a follar
que el mundo se va acabar

domingo, 15 de mayo de 2011

Un cuento de burros y de infancia

¡Aun quedan burros ¡

Me refiero, claro está,
al cuadrúpedo ,
No al mucho animal,
que anda medrando
en campo y ciudad.

De estos mejor no hablar,
no vayan a darte un mitin
o ponerse a rebuznar.

¡¡Que animal!!

De mis encuentros ecuestres con tan magnífico ejemplar quiero hoy relatar alguno, que dieron en su día que hablar.
Tendría siete u ocho años cuando fui nombrado, (a dedo) el encargado general del suministro de agua para el hogar.

Mi vecino Manuel, de apodo Tarambanas, también era encargado general. Aunque colegas de cargo, él a mis ojos era especial… disponía de tracción animal. Un burro de tranco largo y mirada criminal.

Un día, a su llegada como jinete de la fuente la Leandra, con sus cuatro cántaros llenos hasta las trancas, me dio una envidia que te cagas hasta el punto de atreverme a pedir al padre Tarambanas el préstamo del rucho con muchas ganas.

No sé bien lo que le diría, la cosa es que accedió después de algún consejo, que en mi gozo no atendía. Internamente ya estaba planeando una ruta más larga para disfrutar durante más tiempo del bien.

Me proponía ir a la fuente fría, de aguas benditas para ablandar los garbanzos, además el paseo montado con regodeo lo podría observar todo el pueblo.

Por la calle Calvario fui mirando a los lados como cualquier general a caballo que se sienta vencedor.
Al final de la calle, al equino le entra un repente y le da por ponerse trotón. No lo puedo dominar. Cada vez corre más. De golpe.. y porrazo, se para en seco.

Vaya guarrazo. Mi dignidad por los suelos, mi sangre tiñendo de rojo mi ya escaso pelo.

El animal se encabrita y comienza un baile extraño con la sabia intención de romper también los cántaros.

Tierra trágame. ¡¡Verás mi padre!! Palizón. El borrico a lo suyo. Ya se había cargado tres cántaros.

Mirada enloquecida, crines de puerco espín, orejas puntiagudas y la sana intención de montar a una burra, que fue la culpable de to.

El borrico se había puesto muy borrico intentando calzarse a la burra, cosa que no logró por la firme oposición del amo la burra que, con mucho esfurzo y ayuda hasta divina, a remate lo impidió.

El burro no se calmó.Ni perdonó la afrenta.

Por centímetros no le acertó la dentellada que le lanzó. Al momento hubo jarabe de palo, hasta que se le engurruñó y salió del trance.

De vuelta, el animal no quería llegar.Tampoco yo. Ambos dos volvíamos sin proezas que contar.

viernes, 6 de mayo de 2011

Vamónos de feria

A la feria de abril
van dos cigarras.
Peinetas de marfil
y las guitarras

Vestidas de lunares
las mariquitas,
bailan por soleares
las más chiquitas

Claveles en el pelo
lleva la rana,
mantón azul de cielo
su prima hermana
........

De mi Sabelilla
por seguidilla

lunes, 2 de mayo de 2011

Día del trabajo

Ayer fue día del trabajo. Poco ha cambiado

Esto es copia de algo que escribí a principios de Mayo de 2008.. Hace tres añitos solo


Hoy es uno de mayo día del trabajo. O de los trabajadores que no se yo muy bien el título que se le debe poner. Creo que ha pasado de ser día de los trabajadores a día del trabajo..Manda carajo!!

Cosas de los nuevos tiempos debe de ser, y sin duda, del relajamiento del proletariado que de pronto se ha visto con créditos suficientes para ser ricos perdidos.
Ahora vamos de vacaciones y a comprar a EEUU. Y a los más recónditos rincones..Con dos cojones..

Y hay que ir de sobraos..que no somos unos desgraciaos..¡¡¡por dios!!
¡¡Camarero por favor..ponga otra hormigonera de caviar!! Pero que sea iraní..que la hormigonera de antes me ha dado en la nariz…que no era de allí.

Y así hemos ido hasta ahora. Tirando.

Pero a Manolo, el del zaragozano, le han dicho que apriete el puño aunque se pierdan clientes..

Y allá ves en romería a la clientela de todos los días reunidos en comandita..Hostia tu, que el Manolo me ha denegado la ampliación de la póliza, y no tengo guita ¿Qué van a decir de mi en Sevilla y en todas las tierras que riega el Guadalquivir?

Yo no me puedo perder el Rocío..me voy al Cofidis..

Señor Mamoncillo hemos estudiado su caso. No vemos problema en su situación financiera..firme aquí por favor .Y no se preocupe, porque en menos que se persigna un cura loco tendré en su cuenta un pastón… para que siga usted su fiesta.

Usted lo podrá devolver en treinta y seis cómodos plazos ¡¡¡que la vida está para vivirla señor Mamón!!. Solo le cobraremos un 27% de nada

..que le vaya divino!!

¡¡¡que se “jinche usted de vino” ..y ya sabe usted lo que hay que hacer si se pone a tiro un chumino …¡¡quien pudiera don Mamón, usted si que sabe don Mamoncillo y no olvide que si reunifica sus créditos con nosotros ..pagará mucho menos..

Pos ¡¡Viva la revolución!!

¿Quién tiene cojones de llevarse a Mamoncillo a una manifestación? ¿Quién lo pondrá de huelga?

A la vuelta del Rocío con agujetas del camino, ronco de cantar, y aún con resaca del fino llega don Mamón al trabajo.

Y le dice el más pelotas “que dice don Jefe que subas”..
“¿Qué mierda querrá este? Con lo malico que vengo. Aguantar a primera hora un sermón es lo que me faltaba.

Hola Mamoncete ¿qué tal la romería?

Sin tiempo para escuchar la respuesta de una pregunta absurda, le pone en la mano un sobre con “su” liquidación.

“Hay que hacer un reajuste der copón. Eres el mejor mamón, lo sabemos y agradecemos los muchos años que te has dejado los cuernos aquí pero después de una ardua discusión, el consejo de administración ha decidido prescindir de ti que eres el que mejor está en cuestión de economía ..Vaya fiestón te has pegado cacho cabrón..ya nos gustaría a nosotros, los del consejo de administración!!..Aquí estamos para lo que necesites..y bla , bla, bla..

Han pasado seis meses y Mamoncete no responde..no atiende.

No paga las letras, le ha dado por el alcohol..empieza a insultar a su mujer.
Los de Cofidis sus salvadores, ya han ordenado un embargo preventivo de la casa.
Ayer fueron a medir.

Hoy es fiesta y menos mal que no funcionan los juzgados. D. Mamoncete de apellido Infeliz ha dejado de ir a la manifestación..Para que??

Si ya no tiene trabajo..

Día de la cruz en Granada 2011




Foto tomada de la red

Día de la cruz en Granada.
Llovió por la noche
y siguió de madrugada.

Gitanas de buen ver,
mojadas hasta las bragas,
degustan con placer
una saladilla aguada.

Fiesta grande en Granada.
¿A quién le importa que sea mojada?

domingo, 1 de mayo de 2011

Bala perdía

Alguien dijo de mí, en el pasado:
"Tienes la cabeza más dura
que la rodilla una cabra y
más grande que un mulo blanco”

Y huro por dios
que no es para tanto,
según mi opinión.

Aunque, a veces,
no estoy seguro del .

Hay munchas cosas que no aguanto.
Ni predico, ni abdico.

¿Para qué sirve el sarcasmo?

Sigo caminando.
Alta la cabeza.
Oído fino.
Lengua de escopeta.

Me encanta que me tomen
como en realidad soy
…..
Un completo majareta
un bala perdía

sábado, 30 de abril de 2011

Desvarios con escalo fríos

Me levanto deslomado.

Agujetas, sin exagerar,
hasta en la punta
..del paladar.

¿Qué ha pasado?

" Lucha de sexos total"

Afuera, adentro.
Escalofríos.
Placer inmenso,
que dura un momento.

Pierdo la noción del tiempo.

Volvemos al comienzo.

Afuera, adentro.
Placer intenso.
Inmenso sueño.

Pero al momento
…afuera, adentro..

La sábana que no la encuentro
Empiezo a sentirme violento.
Otra vez, frío intenso.

Me levanto.

Tomo la decisión
de arreglar el edredón.

Me duermo de un tirón
...

Noche de frío del copón

viernes, 29 de abril de 2011

Sevilla

Jazmín y azahar.
Río. Cajoneras recién ” cagás”
Chiringuito de Triana.
Torre del oro.
Vino oloroso.

Gamba blanca de Huelva.
Jamón negro de la Sierra.
Manzanilla fresca.

Habano recién hecho,
por un maestro cubano
que es negro de una mano.

Más guiris que sevillanos.

Con todo el tropel,
allí se quedó la silla.

Así que habrá que volver

domingo, 17 de abril de 2011

Irreverente

Pasados ya en algún mes, los cincuenta y tres
me sigue ganando la intrepidez
y la irreverencia que me acompaña
desde los primeros años de mi niñez.

Me alegra ser irreverente
aunque sepa con certeza
que no está de moda en la gente
que se esconde tras su careta.

Nunca atendí al sermón
ni a la obligación impuesta.

Mi padre me castigó
y yo le cerré la puerta.

¡¡Palizón!!
Pero el partido lo vi yo

Sigo cambiando hostiones
por hacer lo que me salga
de los cojones.

Espero seguir irreverente
por siempre jamás.

Y al que le moleste
que le den por el agujero anal.

por no decir por el culo
…y faltar

sábado, 16 de abril de 2011

En paro

Cuando tenía trabajo
(se observe que lo digo en pasado)
me daba vergüenza decirlo
por no ofender, a ningún parado.

Ahora, que también mamo
de la teta del estado,
digo alto y fuerte
que me suda el carajo.

He dejado mi actual trabajo
¡¡y no estoy arrepentido!!
a pesar de la opinión de mis amigos,
que también los ha tenido

Sus sabias opiniones
me hacen saber mejor,
que si me quiero respetar,
he de seguir haciendo
lo que me salgan los cojones.

No deseo cambiar
el disfrute de la vida
por un jornal

Y yastá
….
Otro día más

lunes, 4 de abril de 2011

Velatorio

Este fin de semana, me tocó de refilón, ir a un entierro en el pueblo.
Murió el tío Pedro. Tío de mi mujer, pero que yo hace tiempo hice mío.

Ya no son los velatorios como antes. No me atrevo a decir que peores o mejores.

Distintos a secas. Impersonales.

Ahora, cada pueblo, por chico que sea, tiene un tanatorio como dios manda.

Con sus sillones de eskay, con sus plantas de plástico. Sala de sillones desvencijados, alguno de ellos con el plástico quemado ¡¡tiempos aquellos en los que se podía fumar, sin molestar a vivos o al muerto!!

El muerto yace en el ataúd dentro de una habitación reducida con vitrina.

Al lado, los deudos, pañuelo en mano, se ven llorando cada vez que se acerca algún conocido, o no, a expresar su falso sentimiento.

¡¡Lástima de plañideras profesionales!!

Deberían entrar como suplemento en Seguros Santa Lucia, desde mi humilde opinión. "Cinco plañideras, llorando a moco tendido, le van a suponer solo tres euros más al mes".

Me ponga dos de plañideras, pol favol

Continuo, que me pierdo. Bien sabido es que, el que haya pasado por esto en algún momento, sabe de sobra que pasado el pésame, el velatorio no se sabe bien porqué, pasa a ser jolgorio.

La retranca de los de pueblos toma su máxima expresión a una hora determinada. Es preciso otear con atención la víctima, y no menos importante, audiencia y la frase rotunda que dé comienzo a la "conversación".

"Azu illo, ¡¡ qué no te he conocio !!" (Excusa para dar énfasis al asunto). "Vaya porcino te ha salió entre er pezquezo y er ombrigo" (Brevedad sin concisión en el ataque frontal)

""Psss, que no es un porcino, salvaje, a la vista está que es un tolano sin reventar" digo a modo de salvación

" Zi..habrá zio por tol ano, y ta llegao a cuajar".

Otro, interrumpiendo al primero sigue: "Pa ceh una ehpinilla, la tieneh medio entociná. Lo mihmo con er puh, no te pues ni agashar"

El de más allá: ¿ No te estorba pa follá?... ¿Qué zabrá ehte lo que eh ezo? Auhhhh.. como el aulllio er lobo

¿nos tarah embarazao de verdad illo, que te veo gana gomitar y medio amarillo?

Hoy le tocó al agitador ser agitado. Pero no por todos los lados. Solo por el panzón. Y eso que estoy calvo del copón.

Me gusta la gente de pueblo, aunque no me gusten velatorios, entierros ni tanatorios.

jueves, 31 de marzo de 2011

Gorda la tengo

Gorda la tengo,
más la quisiera
Tal que no me entrara
ni una escupidera

Por encima de la sesenta,
¡y no me entra!!,
Eso que tengo al cero
la cornamenta

En vez de sombrero
me voy a tener que poner
las bragas de una mujer.

En concreto de mi vecina,
de culo como un tonel.
No quisiera estar a su lado
cuando se llegue a peer.

Desgracia grande la mía, joder

miércoles, 30 de marzo de 2011

Sin maña na

Eternas las mañas del majareta
que camina apretando asaduras,
metiendo culo, prieta la cintura
no se le vaya caer la pañeta.

Dolor por todas las carnes. Hambruna.
Gana de mear. Atranque de bragueta.
No pasa el reloj ni pa dios, de la una.
Sueño la huida en burra o bicicleta


Por un plato puchero con pringada
doy más de lo que en la bolsa tenga
por la rubia helada, la mesnada

Llena la boca de tales pitanzas
entran ganas de uncir coyunturas
¿ Te apuesta que me estorba la panza?

martes, 29 de marzo de 2011

Desisto

Quiero escribir serio.

Un C E R I O
Intento sale de dentro

Enmendarlo ¿Enmiendarlo?
R I S U E ÑO
Otra vez SIN REMEDIO.

NIRVANA
Olor a queso

PUDOR del fresco.
Ojal con huevo
Desfile de cojos
Erizos en celo
Reuma de estraperlo

viernes, 25 de marzo de 2011

Sin Caemino..solo cansado

Se me sierran las compuertas
y me pesan las pestañas.

Dolor punzante de cabeza
Pinchazo agudo de entrañas.

Viernes tarde del currante.

El lunes prometo cambiar
lo de jefe de ventas, por viajante.

Me cago en lo que verdeguea
…dios mediante…

Amén

miércoles, 23 de marzo de 2011

Vuelta a Caí

He vuelto hoy a Caí.
llego entero,
pero hecho magnesia.

El traqueteo de la Picasso
se me amontona en las vértebras,
en la columna, y en la corcusilla el culo.
Pssss..que no es un bulo


A Eolo se le fue la olla
de tanto y tanto soplar.

¿Sabría el mamón que
mi menda iba pallá

¡¡Viento de más!!

Olas que lamen las playas
adelante y hacia atrás.

Campos pintados de amarillo sobre verde.

Motas de blancos de los jarales
que se amontonan por lugares.

Vacas pastando.
Ovejas careando.
Patos volando.
Cigüeñas planeando.
….
Negro sobre blanco.

Dos águilas perdiceras vigilando.

Sigo transitando..

Poco a poco nos
vamos acercando

El viento no cesa
¡¡Ozú que sorpresa!!

Tiembla la Picasso.
Nos acercamos a la presa.
Dolor de cabeza.

Llegamos al lugar
..sin derrapar
y sin que nos haya pasado ná

Antes de entrar,
toca mear

Llegado el momento
..jalamos..

Aquí se me olvidan
toditas mis penas
y se me ilumina el paladar

..En Caí
se come fatá

¿La ventresca?

Permita que no diga más.

..Sabor a mar!!

lunes, 21 de marzo de 2011

Me voy pa Caí

Mañana, si nada me falla
salgo pitando para Cádiz
a primera hora de la mañana.

Azules intensos. Verdes y blancos
Viento .Ligera bruma.
El estrecho pintado de barcos.

Vacas marrones pastando.
Colorido entre las dunas.
Un pescador pescando.

Olores a mar invadiendo.
Manzanilla y camarones
El mejor flamenco.
…..
Ya me estoy yendo

Cierra el Cebollas


Foto A. Aguilar

Cierra el Cebollas Palace, uno de los sitios más visitados de Graná, con permiso de la Alhambra, claro está.

En los años setenta, este singular bar, estaba todas las tardes a reventar. Allí se daban cita por las tardes estudiantes, músicos, militares, albañiles, enfermeras y socorristas.

En la plaza de la Merced está, o estaba, mire usted. Al lado del Triunfo, el Arco Elvira y la Gran Vía.

El local es chico de más. La clientela..tela. Los más borrachos y desperrillados de Graná, nos dábamos cita por las tardes en el rodal.

Antes de que existiera el concepto de Pub o el botellón, ya estaba el Cebollas sirviendo sus afamados cuba litros, en un frasco de Fruco cuando había, o vaciando una porción de la botella de Coca Cola o Fanta y añadiendo un generoso lingotazo de ginebra.

Manuel, se llamaba el dueño.Manolo para los amigos. Hace poco que ha muerto y seguro que el Señor lo tiene en su gloria, por los muchos "bienes" que ha hecho.

"Manolo, dale a la palanca, y tira más Fanta".

Lo de la palanca es porque, aunque parezca inaudito, el Cebollas para algunas cosas era súper moderno.

¡A ver quién es el bonico que ha visto tirar ginebra por un grifo! Como los de cerveza, sí señor.En el año 75, ( o por ahí) ya se tiraban allí

Al acercarse la primavera y hasta bien entrado el otoño, allí se despachaban cuba litros a mogollón.

Entre el año 1975 y el 78 del pasado siglo, los jueves teníamos cebollón. Uy!! Perdón quería decir reunión. Siempre en el mismo lugar. Siempre a la misma hora.

Siempre con los mismos resultados.

El Cuba litro costaba a 60 pesetas. Años después, alrededor del año 80, al Cebollas se le fue la cebolla..y llego a ponerlos a cien.

¡Maravilla de años aquellos! Y ¡¡que sitio!!.

Algún jueves hubo que no juntábamos suficiente capital para la bacanal y allá que nos plantábamos en el "roal".

No hubo ni una vez, que recuerde, que después del sermón y del "Esto no puede ser, esto va ser mi ruina" no obtuviéramos nuestra ración.

En mi ya larga vida, pocas personas he conocido tan desprendidas y tan diligentes como tú.

Contigo y con el cierre del Cebollas, se va una parte muy importante de mi juventud.
Que Dios te guarde en su gloria, Manolo

viernes, 18 de marzo de 2011

Viernes

Hoy me ha costado un imperio levantarme.

Hijo de puta el reloj.
A las siete de la mañana
ya me estaba tocando el tambor

¿Dará chispas la bujía
que enciende los ánimos
de mis días?

Dios dirá..

Vamos a esperar

Cinco minutillos más...
¡¡que esta la cama absorbente!!
estos segundillos me hacen
mirar la vida de frente


El segundero va que se las mata
¡¡como acelera el cabrón!!

Va, sin duda
a una velocidad
que como se descuide
tiene cohhones de derrapar...


¿Se estará tomando algo el reloj?
Ozú por dios…

Levanto el párpado y observo
lo follaísimo que va

Hostia!! no me queda remedio
¡¡que me tengo que levantar!!

Vaya mierda de reloj,
y vaya mierda de obligación
Precisamente ahora que navegaba
entre nubes de algodón
me tengo que levantar


Me cago en la pena negra
me cago en la obligación..

Y en mi mala disposición financiera
que provoca
que le haga caso a un reloj

lunes, 14 de marzo de 2011

Viaje a Badajoz

Precioso el campo.
Verdes inundados de charcos.
Amarillos solitarios.
Arroyos que se pueden navegar
Encinas preñás

..no deja de diluviar

Chaparros,
ovejas blancas careando
junto a toros pardos,

..llega el viento de atrás

Jolgorio en el retamal.
Movimiento de brazos sin cesar
....
La Picasso a punto de centrifugar

Sobre un verde otero moteado de negros
atardece el animal:el GUARRO
repasando sus chaparros
y aprendiendo la lección

Principios de buen jamón

Viaje

Ruge como un león calvo y mellado
la cascarria de auto que me han dado.

Ya va teniendo los temblores de su edad
Si se le suma lluvia y viento
mi viaje a Badajoz,
se presenta como un divertimento
más bien atroz

Jacchiis,

Na más de pensarlo me da
la tos.
Pues eso,

Adiós
…que me voy ya pa Badajoz

jueves, 10 de marzo de 2011

A mi(s) compañero(s) acusador

Finísimo olfato.
Lengua de sapo.
Ligeros zapatos.
Alma de trapo.

Inventor de escenarios.
Contador de cuentos.
Realizador de inventarios.
..
Inquisidor innecesario.

Embustero
Lenguaraz
Envidioso
..
Pertinaz

Sigue olfateando,
los pedos
que por el camino
me voy tirando.
..y mientras enredas
los vas pelando

domingo, 6 de marzo de 2011

Con cuatro huevos

Esta mañana me he levantado hecho un león, sí señor. Me he tenido que batir el cobre ¡¡con cuatro huevos!! ..no con dos.

A veces, cuando la necesidad aprieta, sacamos fuerzas de donde no creemos tenerlas.

Confieso que a mitad de la batida, le he tirado a la cara un puñado de harina. A mi adversario le ha cambiado el color, pero en mitad del fragor se ha ido poniendo duro como un peñón.

¿Con qué esas tenemos no? Ahí va un buen chorreón de aceite, cabrón. Otro de azúcar, yogurt y ralladura de limón.
Y te voy a seguir dando hasta que te salga espumilla por la boca.

Anda, cómete estas nueces y tómate un respiro.¡ No me jodas que te gustan con azúcar! Se me ablanda el corazón mientras te doblego y te miro con mirada de borrego.

Ahora vas derechito al talego. Cuarenta y dos minutos después, estarás hecha un pincel.

Guapo. Sugerente. Y me entrará como siempre, ganas de hincarte el diente

Si te quieres pelear, lo que sigue es lo que tienes que emplear:

1. 4 huevos
2. 1 Yogurt natural
3. La mitad del vaso del yogurt, de aceite de girasol
4. 1 Vaso y medio de azúcar
5. 250 gr de harina para bizcocho
6. La ralladura de un limón
7. Puñadito de nueces tostadas

Todo de golpe no lo vayas a echar, no me seas animal.

Lo primero y principal es que batas los huevos hasta casi reventar. Le incorporas el azúcar. Sigues con el juego de muñeca hasta que se diluya.

Aleluya, Aleluya!!

Incorpora el yogurt. Sigue dándole tú. Añade aceite y la ralladura del limón.

¡¡Esaa muñeca!!

Ve agregando la harina tamizada (lo miras en el google si no lo sabes) y batiendo con energía. Ya te va quedando menos. Terminada la obra maestra, le agregas las nueces y lo vuelcas en un molde que previamente habrás embadurnado con mantequilla y algo de harina.

Horno a 190º en la parte baja. Antes de meterlo rocía con dos cucharaditas de azúcar cristalizada. No es una marca. Se hace rociando unas gotas de agua sobre el azúcar y un batimiento ligero..un movimiento sexi y un poquito para abajo, para abajo..BOMBA!!

Ea. Ya tienes tu bizcocho!!

sábado, 5 de marzo de 2011

Antes y después

Acabo de cumplir cincuenta y tres tacos. Es largo hasta de decir. Uno. Dos. Cortos del copón. Pero cincuenta y tres es más largo que un ciempiés.

Pero lo llevo muy bien.

Me quedo corto por pudor. Diré mejor superior, aunque pueda sonar a farol.

Ayer me entrevistó una persona mayor..(quiero decir bastante mayor que yo) Tendría el cacho cabrito lo menos cincuenta y cinco!! Y me hizo una proposición..

Estoy que no duermo. Me invade ilusión y desconcierto al cincuenta (sin tres) por ciento.

Lo mismo me hago famoso a mi edad!!
He dicho famoso, no "fimosis", gracioso.
Mira que si me llaman del hollibud ese!!

Menos mal que allí está el Banderas, que parece un tío que hace honor a su apellido. Me va a venir fenomenal para entablar relación y hacerme un nombre allende los mares.

Porque yo, esta gran oportunidad a los pies de Dios que la pienso aprovechar.

Ya estoy harto de ir de aquí para allá cargado de portátil y la lengua" afilá"
.
Estoy cansado de viajar.

Aquí viajaré también, pero de forma organizada y relajada, según me ha llegado a comentar el "viejuno" que me ha llegado a entrevistar.

"Según mande el mercado, y con una semana de antelación, le avisaremos para que se desplace a nuestros estudios" me ha señalado el señor, advirtiéndome que la primavera es con diferencia, el copón.

Según el "viejuno" voy a tener curro para dar y regalar.

Ellos a pagar. Yo a cobrar
¿No es la felicidad total?

Y, lo mejor de todo es que doy el tipo según él para un montonaco cosas, oye.
Me ha dicho el hombre que soy un chollo total para la industria farmacéutica en general.

Voy a salir en los anuncios de crece pelos, los que tienen arrugas, los canos, los que quieren rebajar barriga, los que quieren aumentar la picha, los estreñidos históricos, los que le salen los pelos de las orejas, y mucho más que me ha dicho el lenguaraz, sin que lo llegue a escuchar.

Eso sí, el tío se ha puesto tieso como un garrote al decirme que no aspire a más y que no pierda esta oportunidad que me hará grande.
Iré en la publicidad, como ANTES. A vé si en poco llegamos a despué, y te cuento el cuento americano.

Ahora no me queda del todo a mano.

miércoles, 2 de marzo de 2011

Badajoz

En un cigarro o dos
salgo de viaje para Badajoz.

Me emociona ver chaparros,
alcornoques y guarros
hocicando en la pradera.

Las muchas aguas de la Serena,
el Guadiana en meandro,
los buenos vinos de su ribera.

Buenos quesos.
Mejores chacinas.
Pimentón de la Vera.

El que no haya ido,
se lo ha perdido.

Juro por dios
que merece la pena

martes, 1 de marzo de 2011

Inepcio en preparación




El hombre inepcio, entre los que me encuentro, es mitad inepto, mitad necio.

Rigurosamente al cincuenta por ciento.

Inepto para parar un tren mercancías. Necio par parar una borrica a bocados.
Pero no me quejo, ni me voy dejando el pellejo predicando algo a lo que no alcanzo.

Se bien que a mi añosa edad nada va a cambiar. Si acaso, el que me den por atrás y deje de tener el anillo anal, tan virginal.

Hasta esto me la llega ya a sudar.

Pasado mañana, el que subscribe (léase sus escribe) va a cumplir cincuenta y tres, y por palos que le dé al borrico no está dispuesto aprender.

Reuniré amigos con hambre canina y más sed que una reata camellos, con la sana intención de que me pasen la mano por el lomo…y de no emborracharme solo.

A la reunión familiar (se lee fiestón) no sé bien lo que llevar. Los veintitantos que nos llegamos a juntar, tenemos un excelente yantar..y del trasegar me da hasta vergüenza hablar.

Lo que no han de faltar globos de mil colores, ni cohetes que al subir hagan pin hagan pan. El pan será de Miguel, de esto estoy seguro demás.

Y ya me va quedando poco para terminar.

Me queda que celebrar con los amigos del bar.
Gentuza.
Mecánicos, montadores, y gente desmallada que pierda el perol por una loncha de jamón.

Bueno, el que dice una dice dos. O veintidós. Siempre claro está que quede alcohol para remojar. Unos hijos de puta de verdad, son los amigotes del bar del Gonzalo, que ni en mi cumpleaños me dejan que gane al futbolín. Con lo que me gustaría ganar a mí.

Pero, ya se sabe que soy inepcio hasta para los juegos.
¡¡Manda huevos!!

lunes, 28 de febrero de 2011

Carnaval de Caiz

Este bobatel, no cambia de papel
y como en anteriores años,
le gustaría posar su pinrel
en el carnaval gaditano.

Ogaño,
tampoco va
a poder ser
¡¡Joder!!



¡¡que arte , pissha!!

viernes, 25 de febrero de 2011

Con el ánimo de fiesta

Nota mí ánimo que el lunes no trabajo.
Como dice mi amigo el chota
“Estoy más contento que recién follado”

En Anladusía, arsa killo, arriquitaum
el lunes nos vamos a poné moraos.
¿De manifas?
Anda y caga, si no has cagado

De fino, manzanilla, jamón y pescado

¿Qué dónde va a ser la bacanal?
Mira que eres subnormal.
si te crees que te lo voy a cascar

¡¡Estás apañado la verdad!!

Enga ..a currelar,
que Espaaañaaa está mu mal

miércoles, 23 de febrero de 2011

A mis zapatos 1.0

Por más ínfulas que me dé,
sigo siendo un cobarde.

Hoy al levantarme, con los pinreles
más hinchados que un bedel,
me he puesto la excusa de no tener
la herramienta, para amputarme los pies.

De esta guisa he salido a la ciudad,
dando, porque no decirlo, más
de una y más de dos "cojetás"


Letreros fosforitos me inundan
Se vende. Se alquila. Se traspasa
¡¡Oportunidad única!!

La gente cabizbaja.
Todo anda en Rebajas.

Un vendedor de la ONCE,
subido a una farola
se afana con los billetes
en fabricar una soga
con intención perversa.

Una cabra sarnosa toca
con desenfreno la trompeta.
Un viejo gitano mellado
la acompaña con la pandereta.

Nadie pasa la gorra.

Nadie mira a los lados.
Nadie sabe qué pasa.

O si es presente, o es pasado.

A la gente le ha dado el relente

¿O será un repente?

Me preocupan mínimamente
cuando paso por su lado

Me cago en el remendón
que no aplicó bien el cerote,
ni el mallo, ni los alicates
en mis sufridos zapatos
o en su mala terminación

Me cagó en TODITO TÓ

Ciegos y zambos nos etamos "queando"
...copón....

martes, 22 de febrero de 2011

A mis zapatos

Me cago en el par de zapatos que me martirizan desde que decidí estrenarlos. O sea sé, ayer.

¿Quién me mandaría mercarlos?

Son bonitos. De piel. Negros. Me oprimen los juanetes de los dedos. Me hacen rozaduras por atrás y le dan a mí caminar, un bamboleo más chulo de lo que es normal.

Estoy sopesando si tirarlos o quemarlos.

Ni de coña pienso regalarlos para hacer un enemigo íntimo, cuando se los llegué a probar.

Al principio parecen cómodos, pero a los cuatro pasos, se empiezas a meditar si no sería mejor amputarse ambos pies o andar descalzo

Eso.

Que le metería fuego a mis zapatos sin dudarlo.
Pero se le ha acabado la piedra a, mi mierda, mechero.

sábado, 19 de febrero de 2011

Elocuencias

Hace algo más de cincuenta que me perdí.
A lo que se ve y como dice la canción..
me parece que me perdí
para siempre.

Nunca, por más que lo intento
llego a encontrar el camino
….correcto.

Pero siempre estoy más atento
que un búho para que nadie
se zampe mi tocino
o me quite es sustento.

He visitado mil doscientos psiquiatras,
todos ellos mucho más perdidos que yo.

Y todos a la segunda visita
llegaron a la misma conclusión.

”Quillo no me des más el tostón
y vete a otro sitio a dar la lata,
copón

viernes, 18 de febrero de 2011

Eduardito

Cumple mi amigo Eduardo más años de la cuenta. Está el cacho cabrito cerca de los sesenta. Eso sí, ni de coña los aparenta. Pelo, le queda para rellenar un almohadón al cacho maricón. Arrugas ni una.

De la cabeza no sé si debo hablar. Cacharreta total. Le sigue gustando jugar, y torear!!.
A veces el toro soy yo, otras veces hace de picador. Y da unos pases de pecho del mismísimo copón. José Tomas ..Un aprendiz, que lo digo yo

Siempre que nos vemos lo pasamos fatal. Nos hartamos de llorar, y no catamos el alcohol.
De comer no hablo, porque me puede dar ardor. A lo más, un bocadillo o dos.

Ni a él ni a mí nos gusta la fiesta y muchísimo menos una juerga.
Eso sí, vemos un rosario y nos volvemos completamente majaretas.

¡¡Hoy me toca a mí, hoy me toca a mí!! Se le escucha decir nada más verlo. Dice que el orar y tocar las pelotillas ( del rosario) le da un soplo espiritual y le quita el espasmo muscular.

Un día, de Santa Ana para más señas, completamente sobrios como es costumbre en ambos, nos fuimos a darle por culillo a unos amigos da ambos.

Compramos una muñeca preciosamente horrorosa . De esas con cara de cerámica con vestido rococó, para regalársela a Ana, dueña y señora de la casa

Al entregársela, no se sabe bien si por sorpresa o emoción, se le escapó de las manos..Y menudo hostión pego la muñeca.

¿Que como quedo? Con los morros destrozados. Y sin posible operación

Recursos de trilero. Menuda bronca le dimos al vendedor!! Que sin rechistar siquiera nos la cambio al instante, pidiéndonos perdón

Esa tarde estuvimos hablando de las costumbres de los incas. Se sabe que en este pueblo eran unos borrachines de miedo.
Dice la historia que los muy pendejos se emborrachaban por el culo. Se ponían una caña ( de ahí le viene el nombre a lo que te imaginas), en lo que se viene llamando el ojete y otro le zumbaba el líquido elemento, hasta que lo veía medio lleno.

La pareja ( la de la GC nooo, cojones) andaba enfurruñada. No se cruzaban ni miradas. Y nosotros tampoco.
Serios como garrotes cantando el porompompero a la vez que bebíamos vino de una bota..
Espurreo por aquí, espurreo por allá, larala la la la lala..

A esto nos despelotamos ambos e hicimos uso de su piscina.
Las tres mujeres del lugar se iban a desmayar de ver aquellas tabletas tan bien "formas"

De vez en cuando sacábamos el culo por una esquina y a grito pelado reclamamos ¡¡ Que nos llenen, que estamos secos por los adentros!!

Un cacho pan mojado en leche es mi mi Eduardin.

Hoy vamos a rezar el rosario, serios como estacas y a sufrir..que todo lo tengo que decir

Feliz cumpleaños amigo de mi alma, mi corazón y mis entrañas

miércoles, 16 de febrero de 2011

A mi amigo Juan

Aún le tendrá que sudar el rabo
a la ardilla,
antes de que el menda
escriba alguna maravilla.

Pero tú , amigo Juan,
ha sido coger el legón
y has sacado versos,
rima y composición
De un tirón..

Los cascalamandurri como yo,
apreciamos el talento , del copón.

Somos por lo general gente ñaque.
que pierde fuerza y arranque
buscando la cagada de los lagartos
o un buen manojo de esparto,
para hacer una soga.. y ahorcarse

Para rimas y métricas
no somos incapaces
Pero, ni tenemos paciencia
. ..E intuyo que ..ni arte

Guan ¡¡Viva tu arte ¡!
Y la madre que te parió

Aquí dejo su dirección:
http://juangranadosgr.blogspot.com/

por si alguien quiere leerlo,
algo después que yo

Ni que decir tiene que su lectura
Produce placer…ta en las asauras

A mis órdenes su general

En el fragor de la batalla
no necesito generales
con la guerrera llena medallas
que vayan sumando males

Tampoco voy necesitando
a nadie, que a bocajarro
me descerraje el perol

Puedo bastante más.
Ya lo verás.
Mañana me vas a encontrar
con la honda preparada
Y muchas ganas de pelear

¡¡Dejadme el pelotón
que los arroyo!!
Y fijo que algunos

Me los llevo al hoyo

martes, 15 de febrero de 2011

Signo de admiración

¡A un signo de admiración
se la roto el condón!
¿ habrá dejado preñada
al signo de interrogación?

Un ufano punto y coma
Dice: “Illo se te rompió la goma”

Una enjuta jota bailarina
se junta con la gorda a.
Les entra la risa tonta.
Se ponen a cacarear.


Se une a la función la o
y la muda hache

A los cuatro se les ve
llorar en un rincón
de pura envidia
y de frustración
….
La vida misma, copón

lunes, 14 de febrero de 2011

Día de San Valentín

San Valentín, San Valentín
día de los enamorados
que se hacen regalos.

Yo estoy enamorado
pero tengo el monedero
bastante abollado.

Bendita globalización
Bendito el Corte Inglés
y toda su organización.

Pero no me sale de los egss
gastarme un pastón
para demostrar mi amor

Azín es

domingo, 13 de febrero de 2011

Alpujarra

Launar gris azulado.
Los campos, pintados de blanco.
Florece el almendro.
Llevan agua los barrancos.

En el cerro de enfrente
marrones y verdes,
con amarillos en el tapete.

Olivareros activos,
a palos con los olivos.

En los quejigales
suenan dos tiros
Percha de zorzales

En los cortijos huele a matanza,
a castañas y buen pan de higo
mezclados con aromas de vino

Por la Alpujarra me desvivo

sábado, 12 de febrero de 2011

Crisis

Siempre.
Antes y después.

Ahora.

No te despistes,
si no quieres
que te afanen
la cantimplora.

Mierda de crisis
en la que todo el mundo,
implora
y llora.

Mientras,
a la sombra
de una alameda frondosa
van poniendo precio al continente.

¿El contenido?
..
Hace tiempo que se lo han bebido



viernes, 11 de febrero de 2011

A mi sobrino Alejandro

Sobrino Alejandro,
Ya sé que aún no sabes leer. "Ni falta que me importa" como diría mi buen amigo Antonio Vallecillos, el que anda con una ruina para tres vidas, según él.

También sé que andas escaso de dientes, por no decir, que no tienes ni uno.

Tampoco los tiene cualquier defensa central inglés que se precie, así que no es motivo de preocupación.¿ A qué no?

El nombre marca, no te vayas a creer. Y lo de Alejandro, no es paja de habas.

Pero ya verás que con las enseñanzas de tito Manuel (que ero yo, no se te vaya a olvidar) ya verás que esto es broza.

Ganas tengo, querido Alejandro, que las mujeres no te anden zangoloteando y andes en disposición de aprender.

Te quiero enseñar cosas nada provechosas pero absolutamente ociosas.

Si andas dispuesto, vamos a fabricar barcos de juncos que anegan nada más empezar a navegar. Vamos a pescar barbos a mano. A buscar nidos de tórtola y de perdiz. A poner las trampas. A coger los caramelos de las gayombas, que maduran en el mes de Abril. A perseguir los gusanos de la luz. Y a mil aventuras más, de las que no vamos a dar pistas

Vamos a disfrutar de los que nos da la vida. Y a reír.

Esto último, a lo de reír me vengo a referir, es importante de más. Ya lo sabrás según te vaya carcomiendo la edad. Y lo de disfrutar del momento, tampoco es cosa baladí, que te voy a decir.

Mientras tanto, estate tranquilo y se feliz.

No te precipites en afeitarte (que buena falta te hace), ni en ser lo que tus tías te digan. Hazme caso. Y desde tu corta edad espero, que hagas mismamente, lo que te "zarga de loh güevoh"

El tito Manuel te estará esperando para hacer de ti, lo que se llama y se dice, un autentico zascandil.

miércoles, 9 de febrero de 2011

Cuando hay lomo..de todo como

Este fin de semana, mientras yo me pinchaba , ella , mi bella doncella le dio el barrunto y nos hizo una receta centenaria (de Terry).

Mis pinchazos fueron provocados por rosales y granado, a los que con algo de maña y desgana, los fui podando, no sin llevarme más de mil doscientos pinchazos.

La receta en cuestión proviene de la Alpujarra. Aquí la pongo por si alguno quiere degustarla.
Lomo en orza se llama.

Ingredientes para el adobo para unos 6 kilos

- 6 pimientos secos, puestos en remojo unas horas antes de usar
- 3 cabezas de ajos
- 1 cucharilla de orégano
- 1 cucharilla de canela
- 1 puñadito pequeño de pimienta negra
- ½ vaso de vino blanco
- 4 cucharillas de pimentón dulce
- 1 hoja de laurel seco
- Sal

Y to par mortero, que en nuestro caso es batidora. Una vez bien batido se pasa por el chino para quitar los pellejos del pimiento. Y ya tenemos nuestro adobo.

Elaboración

Se coge la cinta de lomo y se abre por la mitad sin llegar al fondo, con un "guchillo" bien afilado. Después se marcan las tajadas. La pieza debe de quedar entera pero bien marcada.

Salamos y dejamos un ratito para que tome la sal.
Embadurnamos la pieza con el menjunje por todos los sitios y la dejamos reposar en zona fresca durante 24 horas.

¡¡Vamos a freírlo!!



Esto como mejor sale es con leña y a ser posible de encina porque es de combustión más lenta y desde mi punto de vista le da mejor sabor.
Disponemos una sartén grande y con buen fondo a la que agregaremos una tercera parte de manteca de cerdo y dos tercios de aceite virgen extra de oliva.

Colocamos las tajadas y las ponemos a fuego fuerte al principio meneando de vez en cuando para que no se peguen
A mitad de cocción se disminuye el fuego.
Una vez que se están terminadas se dejan enfriar un poco y se vierten sobre un recipiente que cubriremos con el aceite que pasadas unas horas se solidifica convirtiéndose en manteca

Que aproveche

martes, 8 de febrero de 2011

Sombrilla y mantel

Me cago en to mi apellido!!

El medicucho que me mal nutre,
me decía que me veía
estupendísimamente.

Hoy me ha echado una foto
y fíjate como he salido.




A mi modo de ver,
me falta sombrilla y mantel.

Juro que no sé lo que voy a jaser.

De momento voy a trincar lo botella,
y me la voy a beber

Cachis en diez
..como me pesa la plebeya

lunes, 7 de febrero de 2011

Lunes

Lunes. Resaca. Mala gana.
Calentita estaba la cama.

Resignación.

Café, tostada de jamón.
Ducha, lustre a los zapatos.
¿Qué corbata me pongo?

Indecisión.

Coche. Música clásica
Carretera atestada

Me duele el pescuezo
¿porqué será eso?

Me cago en mi suerte.
En mi pelada cartera.
En los donuts
Y en mi situación financiera

Cagón TOOOO, copón

viernes, 4 de febrero de 2011

Se acabó

Surgió como de la nada.
Bajé la espalda y mi vecina Dolores,
que acompañaba,
se llevó un puñetazo demoledor.

La Dolores, KO quedó.

Antes de caer al suelo como un pellejo,
se le escucho decir:
¿Hasta a mí me vas a pegar, Manuel?

La atendimos como es debido..
y, a decir verdad, como dios nos dió a entender

Luego, seguimos cada uno en su papel.

Él, mi padre, zumbando.
Yo, fajando y aguantando.

La Dolores, recuperando

No hubo nunca después,
una situación similar.

Ese fue el final

Tenía dieciséis años.
No más

dan nohgmal

Menos mal que a las personas humanas nos hizo el señor dios de carne y hueso. Si nos hubiera o hubiese hecho por ejemplo de latón, yo tendría en el cuerpo abolladuras del copón.

Me intentaron domar a base de hostias. Un día sí y al otro también. Pero no lograron cambiar mis ansias de libertad, de hacer lo que me dio la real gana desde muy corta edad.

Yo cambiaba una buena paliza por un baño en el río. A la vuelta buscaba nidos y como el agua daba hambre de más, ¿quién era el bonico que no se metía en el melonar a robar?

Paliza asegurada.

Alguien más espabilado, llegó a decirle a mi padre que si me quería domar tenía que cambiar la táctica.”Un castigo ejemplar te ayudará a enderezar al animal”

Un día que no le había echado de comer a los guarros, y los cántaros no tenían ni gota de agua mi padre aplicó su enseñanza. "Mañana te quedas sin ver el Madrid"

A lo que yo pensé: "Y un cojón pa ti".

Acercándose la hora del partido, un Madrid Barcelona, el castigador en un arrebato, se va echar de comer a las gallinas. Y hete aquí que la puerta del corral tenía un cerrojo para entrar y otro para salir.

No sé describir la emoción que me recorrió el cuerpo al verlo entrar al corral. Tampoco medité de más, y allí lo deje encerrado. Ala, por malo.

Cambié el partidazo por otro palizón. Pero a remate el que vio el partido fui yo.

Mientras, él se preparaba, entre las gallinas, conejos y cabra para "charlar" conmigo nada más terminar el partido. No se creyó que no hubo intención.

Palizón.

¿Quién perdió?

El partido él. Casi un ojo, yo. Pero me sudó un cajón con o.

Dios guarde en su gloria a mi padre al que le debo la vida. No le guardo ni gota rencor bien lo sabe dios.

Eso que dicen de las secuelas sicológicas, solo le pasará a la gente de ciudad.

borgue yo esdoy dan nohgmal

miércoles, 2 de febrero de 2011

Como los huevos de un toro

Ayer hizo un frio antiguo en Granada,
y a mi persona pelona lo pilló
desprevenido total.

Esta mañana me noto voz del Padrino
y gazi no buedo hablar.

Ando fatal.

La reuma de una pata
me hace dar "cojetás".

Sinfonía del pecho,

musiquilla "desafiná".

Encima tengo que ir a trabajar.

Lo mejor de ” tó”,
es que debo hacer una demostración,

..y me parece que la voy a jaser gestual

Dios dirá

lunes, 31 de enero de 2011

Diptongo

Cuando uno quiere ser diptongo,
e hiato a la misma vez,
no te ha de sorprender
la de hostias que te van a caer.

A ver cuando te enteras, Manuel

Me duele el anillo

Tengo, lo que se da en llamar,
el agujero del culo u ojete
como un bebedero patos,
mal que me pese.

Tiempo atrás no me cabía un junco
y llegada esta hora, se traga un barco.
¡¡Y un transatlántico de lado!!
Hay que ver a lo que hemos llegado

♪ ♪A tomar por culo matarile lile lile
A tomar por culo matarile lile lón
¡¡Chimpón!! ♪♪

Me encanta y me define esta canción

Seguiremos informando.
Corto y cambio

domingo, 30 de enero de 2011

Pongamos que hablo de Madrid

Barba de mil días. Pelo enmarañado
Coleta como una ristra de ajos.
Sombrero que fue de paño
De los mitones mejor no hablo.

Tabardo pardo sin un botón
Pantalones de color añil
Botas risueñas de cazador

Sonrisa en los labios.
Inmensas ganas de vivir

Pongamos que hablo de Madrid

sábado, 29 de enero de 2011

Olor a cortijo



Chispea en Granada
Por momentos jarrea.
El cuerpo me pide
sobredosis de chimenea.

Oler a cortijo,
a pan de de Miguel.

A buen tocino,
mejor vino.

Y lo mejor de tó
..a juego con los sobrinos

viernes, 28 de enero de 2011

Sensaciones con sabañones

Hace un día más que estupendo
para capar hurones, pescar al acecho
y/o tocarse la flauta marcha atrás
...
detrás ¡¡faltaría más!!
de un oso desdentado
y un almendro amadroñado

Tampoco pinta mal,
pa ir a la caza
del gazmoño vertiginoso
con la técina del

"ven pacá casho ahqueroso
que amos a cascar"

Días asín
solo se dan en Madrin

jueves, 27 de enero de 2011

Día de bodorrio

Hoy me ha tocado ir de boda. Más por compromiso que por devoción.

Se ha casado uno de mi oficina con el que debo haber cruzado un saludo o dos.
Eso si, que todo lo hay que decir, el compañero parece que no es maricón.
Se ha casado con una tía, cosa que en los tiempos que corren casi hay que resaltar.

Me ha tocado por tanto cambiar mi chándal tan ajado por un traje inmaculado. Sentarme a comer con los que todos los días trabajo.¡¡ Y la mayoría de ellos estaban más tiesos que ajos!!.

Iban todos ellos, menos yo, con sus señoras disfrazadas de carnaval, enjoyadas y con cara de estar mal follas, las niñas de princesas horteras, los zagalillos de pajes.

Los demás señores embutidos cada uno en sus trajes, que algunos les sentaba dicho sea con el mayor de los respetos, como a un santo un par de pistolas.

Me perdí a propósito la ceremonia. Me fui directo al restaurante, (Restaurant en finolis) llegando en el preciso momento que entraban los novios y sonaba de forma contundente la melodía de aquel famoso anuncio de los años sesenta y tantos que decía : Lave su ropa con Persil..

Y ..a comer y beber a carrillo ( disculpe D. Santiago) lleno se ha dicho.

La comida con nombre rimbombante, una mierda total como es casi normal en este tipo de eventos. El bebercio a compás.

Y según se pasa del blanco al tinto entre Vivan los novios de una garganta desgañitada, se pasa al que se besen los novios, los padrinos, los del 5º y sus sobrinos. Encima sin poder fumar.

Las mujeres después de la segunda copa ya se han puesto colorás. Y andan hablando de muebles, piscinas y viendo a quien pueden despellejar..Eso si con las manos en una postura poco natural, más que ná pa que se le vean los pedruscos de los anillacos que para sí quisieran lateros y gitanos.

Al salir de allí, me he vuelto a decir: " Quillo y tu ¿Qué mierda pintabas allí?

Déjate de compromisos que ya vas siendo mayor y a la próxima boda que te inviten, no vayas… hazte a ti mismo el favor"

miércoles, 26 de enero de 2011

Despifostio

Hormigas desmaquilladas
se afanan en patrulla
sobre un tobogán de playa.

Un abejaruco observa el panorama.
La falta de abejas, le abren las ganas
Suena el croar de una rana
Cuá cuá ..cua cuá

El arzobispo de Granada
se da bulla en el sermón
no vaya a que se le seque el jamón.

Sobre el rompeolas,
dos tetas
poco sujetas,
se dejan acariciar
por una brizna de mar.

Mientras..
un albañil majareta
se abre la bragueta
y se dispone a mear.

Hace frío hoy en Graná

lunes, 24 de enero de 2011

Mi ídolo actual

Toda persona que se precie debe tener un ídolo. Un espejo donde mirarse que le ayude, le guie y le sirva de modelo.

Estos modelos pueden ir cambiando según en la edad que estemos. Todos hemos querido ser alguna vez artista, cantante, bombero, torero, futbolista o jardineros.

Admito que, de estos últimos conozco menos. Ninguno para ser sincero.

Yo, a una tierna edad de la que aún guardo recuerdo, quise ser cura misionero. Recuerdo que le mangaba a mi abuela un vestido negro y una vez dentro, armado con una galleta María y un vaso de agua, recitaba la misa como un papagayo sin saltarme un gesto o un paso.

Tenía mis feligreses y algunas feligresas con las que jugaba a los médicos, poco después de la santa misa. Como no teníamos camilla, bien nos servía una mesa

Después quise ser El Cordobés. Manolo Orantes. Gento ..y muchos más de los que ahora no me acuerdo

Llegada esta edad sigo teniendo mis modelos. Le quito el plural. Mi modelo en singular. Es uno, pero ya verán que el ladino, es muy especial.

Me pirro por el zagal, oye. Con ese porte. Con ese saber estar. Es la caña, la verdad.

Cada vez que lo veo, me planteo que si hubiera personas así, España sería otro país.

¿Qué a quién me quiero referir?

Al niño que con cuatro años anuncia la financiación del Renault, que en español se dice "ggenó".



¡¡Que primor!!

¡¡Vaya manera de gestionar tiene el chaval!! Después de gastar en gominolas, gusanitos y demás "panfollás" le da al cacho cabrito para gestionar sus ahorritos.

Nunca vi nada igual. Y desde aquí confieso, que es mi ídolo TOTAL.

Ya me gustaría a mí tener su capacidad, a mi ya larga edad

¡¡Me cachis en la mar!!

domingo, 23 de enero de 2011

copiosos copos con coñá (c)

Copiosos copos caen concatenados.
Cellisca célica celícola canjeada.
Crepúsculo con cencellada

Ay que ver la que estoy liando
para decir que está nevando en Granada
y que se anuncia helada de madrugada .

La fiebre del domingo por la mañana
o ¿era del sábado noche?
me hace delirar y decir "chorrás".


Prometo no cambiar más
el chupito de bote
por el trancazo coñác

sábado, 22 de enero de 2011

Tengo una tranca mu grande

Tengo una tranca tan grande, que bien se le podría llamar trancazo. No voy a decir que sea la mayor del mundo. Parecería pedante. Pero si se le ha de poner nota, estará en un notable alto rozando el sobresaliente.

Escribo esto aquí sin ningún pudor porque en la España actual, uno se puede expresar.

Los hombres van a pensar que soy un fantasma total, y las mujeres no se van a poner, como antes, "colorás".

Si acaso alguna osada te la quiere ver e incluso tocar.

Un desparrame total, la verdad.

A los que les pasa como a mí, yo los noto desde lejos .Se nos ponen los ojos con mixomatosis, como a loa conejos.

Si vamos en el autobús, la gente se aparta de nosotros al primer jachuus, con su consiguiente pañolada y ese sonido tan peculiar que se asemeja bastante al del tren cuando va arrancar.

En fin que ando fatal.

Y esto que ando escribiendo debe ser un delirio de la fiebre y tal y tal.

Me voy a la cama. Lástima que no conozca a ninguna Bartola que me quisiera hacer el favor de quitarme este dolor.

Yo he escuchado que esto cura tirándose a la Bartola en la cama varios días. Y a fe que yo daría la mitad de lo que guardo en la alcancía por tal de acabar con esta enfermedad

Jachisss..!!

¿Una calada?

viernes, 21 de enero de 2011

Las ganas de vivir

Toc, toc
¿Se puede pasar, o no?

Me llamo Depresión.

Depre para los amigos.

He visto la puerta abierta
y vengo a invitarte a una fiesta,
donde no va a faltar sexo,
drogas y rocanrol

¿Te animas o no?

No me seas petardo
¡¡Lo pasamos siempre del copón!!

El ánimo mohíno se anima
..ya camina
Va abrazado por el pescuezo.
La Depre lo mima y lo encamina.

Dos días le ha durado la última resaca.
Dolor enredado en sudor.

Ha llegado el momento que Depre esperaba.
Tiene las defensas bajas.
Es el momento meterlo en la saca.

En ese justo el momento,
estira la pata el jumento

¿quién ha hablado de morir?

y le da una patada a la tal Depre
que le parte la nariz

Y colorín colorin

Siempre ganan las ganas de VIVIR

Moraleja:
Los chinos se llaman chinos, no por ser amarillos
sino por ser mu chiquitillos.

Si fueran enormes
se llamarían peñones.

jueves, 20 de enero de 2011

Rebajas: Vendedor en oferta

Vendedor de mediana edad,
no llega aún a carcamal,
se pone en rebajas
dejando la puerta abierta
a cualquier oferta.

¿Experiencia?
Más de la cuenta.

Dispuesto a viajar.
Siempre, claro está,
que la empresa
pague la fiesta

Precio a convenir.
siempre que sobrepase
en algo los tres mil.

Limpio y ordenado.
Guarrete en privado.

No tengo ambos sexos.
Tan falto de pelo.,
como de idiomas

De informática
en el corta y pegar
soy un hacha total

Que yo recuerde
no cumplí con los objetivos
JAMÁS!!

Una joya
de las que escasean ya

¡¡ No pierda su oportunidad!!


Y llámeme ya!!

Incontinencia

Querida Concha Velasco
tenemos algo en común
(¿me permites que te hable de tú?)
que se llama incontinencia.

Tu, porque no se te escape el pis
yo, por escribir

Me apuesto un guevo
querida Concha,
que esto que nos une a los dos
con el tiempo irá a peor

¡¡Yo ya tengo un lector o dos!!

miércoles, 19 de enero de 2011

De rebajas y bollos

Con la yema de los ojos veo
hordas de carteras arremolinadas
delante de un letreo
que dice REBAJAS

En el centro, yace un monedero desdentado
que al parecer hizo un comentario algo osado:
“Mucho postín, pero parece que no hay yesca”.
Con lo que se lió la gresca.

Un pordiosero jorobado,
antiguo gerente de Galerías Preciado,
viendo el follón armado
las ha ido metiendo en una vieja bolsa
totalmente aluciado

Tres euros con cincuenta,
Tarjetas caducadas cuanto ha
Fotos amarillentas
Y un condón
Ha sido lo re coleccionado.

"España tiene el bolsillo como yo,
se le oía al escupir de medio lado.

Absolutamente bollado"

martes, 18 de enero de 2011

Pecados gordos

Quiero pecar todos los días,
ahora que aún estoy en edad.

Antes de que todo se acabe
y se quede yerma la mar.

Quiero pecar pecados gordos
acompañados de una buena "ensalá"
donde un buen manzanilla en rama,

...sea cosa mu principal

Ansiedad

Hay algunos días que me trinca por el pescuezo
algo que no se bien si llamar sensibilidad,
o pura mala follá
En realidad uno, no tiene conciencia
de hacer las cosas, tan rematadamente mal

Lo cierto es que hoy me siento
exactamente igual que
la bola blanca del billar.

Me zumban con un taco,
recién encerado,
hasta debajo del sobaco
y no llego a piar.

¿Alguien tiene tabaco
aunque sea de liar?

lunes, 17 de enero de 2011

Monazo

Me sangra la ganga.
Se me altera la saja
como si me hubiera
o hubiese resbalado
sobre una navaja.

Incontinencia.
Honda pena. ¿O era Derbi?
Mollera atorada,
panza revuelta.
Hora que no avanza.
Aspereza en la mirada.
Estoy hecho un guiñapo.
Mirada de sapo.
Asco grande
Me suda el carajo

¿Alguien me da un cigarro?

sábado, 15 de enero de 2011

De Motril

Peniculón, o flim doblado por la ente Motril



Va zurtitulao, pa loh que no zon de aquí
Yo me partio la polla, de reir

viernes, 14 de enero de 2011

De la olla de San Antón

"Cierto que no hay tal cosa como la olla, digan lo que dijeren; todo lo demás es vicio y gula." Domine Cabra

Llegadas estas fechas, los restaurantes de mi ciudad, se afanan en publicitar la afamada olla de San Antón.

Si no has ganado bastantes kilos en navidad y quieres regular tu colesterol, (más que regular ponerlo a mil quinientos metros del nivel del mar) vente estos días "pa Graná".

El plato viene de antiguo, y a mi modo de ver, debe su razón de ser al atempera miento de los cuerpos en una época del año, en la que antaño debió hacer un frío del mismísimo copón.

No siempre hubo calefacción.
Ni federicos “non frost”.

Y también, cómo no, para aprovechar los productos de la matanza que se ponían en salazón.

Así que, una vez sacados tocinos, caretas, espinazos y rabos de la sal qué mejor que prepararlos en cocción con sus papas, sus habichuelas, habas secas, su mijita arroz, su hueso de espinazo, y su morcilla negra como el charol.

En mi hogar (también llamada casa) la hacemos con algunas variantes.

Las habas secas a mi modo de ver, le vienen mejor al ganado.
Y las habichuelas pueden tener efectos sonoros algo nocivos, fuera aparte del perfumen asesino, que puede arruinar a perpetuidad cualquier olfato fino.

Como la "pringá" no nos parece suficiente, le ponemos costillas saladas, mucho corazón ( de marrano) no me seas mamón.

Tampoco le ha de faltar oreja y un trozo generoso de rabo (también de marrano), so marrano.

Garbanzos, un puñado por comensal, e hinojos que le dan un aroma especial nunca le deben faltar.

Vino mosto de la Contraviesa a mogollón. Pan de Guadix o de Albuñol que es el mejor.

Y más hambre que el perro un afilador.

Este es el secreto para disfrutar
de la afamada olla de San Antón.

Bueno, a decir verdad hay otro secreto más

Esa tarde queda prohibido trabajar

Carroza de Bonanza

Por mor de la salud y tal y tal, me estoy volviendo un ser casi angelical. Me estoy quitando de casi todo, a mi pesar.

A las drogas hace ya una jartá que le di esquinazo (solo me pongo un poquito de vez en cuando, de vez en cuando).

Del alcohol también me quieren quitar. El médico, esposa y niña no hacen más que amenazar y decirme que me sienta muy mal. ¡¡Y un mojón!! Si lo sabré yo que lo disfruto de más.

Las cervezas y los manzanillas de medio día se acabaron cuanto ha. El vino de la comida, que hasta hace nada era esencial, paso a mejor vida. Ha de ser fiesta de guardar para inaugurar una botella.

De los wiskises de la tarde, no me sale un cojón (el derecho) de quitarme ¡Faltaría más!

De las putas no me llegue a quitar porque nunca llegué aplicarme en ningún lupanar. Pero nunca es tarde para empezar, aunque lo dudo más que bastante.

De los juegos de azar, también me quité cuanto ha. Una primitiva, de higos a brevas es lo que llego a jugar.

¿Qué me queda en la vida?
Lo más hermoso del mundo..trabajar, jar, jar, jar

Illo, me ha dado garrotillo nada más pensar a lo que uno llega, cuando está en la preciosa edad entre carroza y carcamal.

Estos mandamientos se reducen a dos:

En verano a la sombra
y el invierno al sol

Y a tomar por el saco tó ¿O no?

jueves, 13 de enero de 2011

Guerra al tabaco v.1.1

Hoy me siento más fuerte que el vinagre bellotas.
De mi guerra declarada al tabaco, todo son derrotas
¡¡Illo, qué trabajo más grande me está costando!!

La única batalla que de momento estoy ganando
es que no he puesto un pie en un estanco.

Voy de amigo en amigo mendigando y llorando
por un cigarro de mierda,
sin que se me caiga la cara vergüenza.

He acabado con los puros coleccionados
de aquellas bodas a las que asistí de invitado

Ahora mismo me ando fumando el de la boda
de mi amigo David..
jumera grande,
panzá de reír.

..y me dio por escribir

Ayer esduve de boda a das las tantas de la noche.
Bigáte que pea no drincaria,
gue tuve gue dejar allí er cosshe.

Udo de da embresa gue salío
dos avisó bor er telefonillo
gue habia un control,
Jate tu,
“”ni gue esduvieramos gorriendo
er Turr.!!

Así que, gon brudencia y boca gana
basadas das cuatro y medía
esdaba el menda betiéndose
en la gama

Ahoda dengo da gabeza
gue padece que me han hecho una operación
y be barece que do han secao bien dos puntos

Borque me hace pon pon, pom POM!!
gon zu redoble y tó

Gomo trinque yo al beaso maricón
gue ve ha betido el bombo en bitaica
da mollera
de voy a begar un hostión
gue le va a estorfar el cielo
Bara dar la vela!!

Auh que balico esdoy, copón

Acabo.
Si aún le queda crédito a mi palabra
he de decir que el puro,
esta más duro
que la rodilla una cabra

Pero me sabe a gloria chaval
..de la celestial

Receta de jabón de pata negra

Receta del jabón de pata negra

Cuando yo era chico mi madre, la Dolores y la Adora se constituían en cooperativa por un día y se ponían hacer jabón.
Allá que las veías al despertar el día ir y venir cargadas con cacharros mágicos, poniéndolos al lado de una gran caldera que se erguía orgullosa, sobre las trébedes enormes que solo servían a parte de eso para la matanza.
Yo, cuando tuve uso de razón llegue a ser “el encargado general” (que se dice pronto) de la lumbre.

Y como si fueran brujas, iban vaciando sobre la caldera los contenidos de aquellos cacharros viejos. Cada cosa a su tiempo. Con su orden y sin dejar de menear con un palo.
La magia surgía cuando llegaba la hora de agregar la sosa. En aquellos entonces eran unos pedruscos grises que había que tratar con cuidado extremo.”Niño!!! ni se te ocurra coger con las manos eso!!.
Y ya no digo ná cuando aquello se volcaba en la caldera. Salía de allí un humillo hediondo que ya nos advertían las mujeres que si respirabas mucho de aquello, caías al suelo redondo y podías pasar al más allá en un pis pas.

Ya no se hace de aquel jabón. Pero, mi fenómena y yo, después de grandes fracasos y llevados por nuestro ánimo de experimentación y por aquello de administrar nuestras ruinas, llegamos a conseguir un jabón líquido o pasta para la lavadora de la que aquí dejo la receta

1 kilo de sosa cáustica
5 litros de aceite del que sobra de la fritanga pero sin muchas fritangas
50 litros de agua
1 litro de lejía color
500 gr. de detergente en polvo de lavar a mano
2 litros de suavizante

Se procede de la siguiente forma:

Se ha de disponer de un recipiente de unos setenta litros.
El que no sepa lo que es recipiente que tire del google o del diccionario que le compró a su niño cuando era chico
Se vierte la cuarta parte del agua , se añade la sosa para que se diluya.
Se añade el aceite. Se menea con un palo largo para que vaya mezclando
Después se añade la lejía, detergente y el suavizante.
Dale que te pego con el palo. Le añades el resto del agua
Así lo debes dejar durante una semana. Sin olvidarte de revisarlo a diario, para darle un poquito de jarabe de palo.
No es necesario que hagas ningún parte de trabajo. Ni lleves la trazabilidad del producto. Pero es esencial el meneo. No de caderas. Con el palo, oiga
Si observas que le falta agua, no seas miserable. Añade una poquita y otra mijita de palo.
Ya te puedes servir un güisqui por lo bien que te va a salir.
He dicho uno, copón. Con más de dos se le suele dar al palo un meneo..que el propio mejunje siente una sensación de cosquilleo. Y ya, no es igual.
Si te tomas más de tres. No lo menees. Tira directamente a la mierda la tinaja y observa con ilusión como se lleva el viento las pompitas de jabón

Transcurrida esa semana , si solo te has tirado al coleto uno, dispondrás de un magnífico detergente para lavadora, a un precio más que competitivo. De seis a ocho euros los sesenta y cinco litros.
Vendo ael litro a solo 3´9999€ portees incluidos excepto para las islas canarias.
Se admiten pedidos. La primera de las D es esencial pronunciarla..

No vayamos a confundirnos